Internal service rates are for Notre Dame-affiliated labs and colleagues at Indiana CTSI institutions. A Notre Dame login is required to view this price list; otherwise, please contact John or Brent about pricing.

Sanger sequencing and DNA fragment analysis

Order forms: Full service | Ready to run

*Full service Sanger sequencing redo policy:
We can re-run failed reactions using the same template and primers, upon request. If they fail again, you will be charged again but you will not be charged if they work the second time.

The Genomics Core Facility provides traditional Sanger sequencing and DNA fragment analysis (microsatellite and AFLP genotyping) on an ABI 3730xl 96-capillary sequencer. Full service sequencing is available where users provide a sample and custom primers (or we provide commercial primers) and we perform the sequencing reactions. We also accept ready to run jobs where users perform their own Big Dye or fragment analysis reactions and provide a sample that is ready to run on the 3730. To submit an order, fill out a full-service sequencing order form or a ready to run sequencing/fragment analysis order form and send it to Brent. Then, deliver your samples to the Genomics Core.

Forward and reverse reactions are considered 2 separate reactions. We will be able to serve you more quickly and efficiently if you provide all of your DNA samples at the same concentration and they are clearly labeled. Provide any custom sequencing primers at 10µM (10 pmoles/µl) in separate tubes.

When sequencing PCR products, use the following table to determine sample concentration for submission:

Template length	Concentration
100-200 bp	1-3 ng/µl
200-500 bp	3-10 ng/µl
500-1000 bp	5-20 ng/µl
1000-2000 bp	10-40 ng/µl
>2000 bp	40-100 ng/µl

For full-service plasmid sequencing, provide at least 300ng of DNA per sequencing reaction.

Commercial primers we currently have in stock are:

M13(-20) Forward:	5' GTAAAACGACGGCCAGT 3'
M13 Reverse:	5' CACACAGGAAACAGCTATGACCAT 3'
T7 (short):	5' TAATACGACTCACTATAGGG 3'
T7 Terminal:	5' GCTAGTTATTGCTCAGCGG 3'
T3:	5' AATTAACCCTCACTAAAGGGA 3'
SP6:	5' ATTTAGGTGACACTATAG 3'
pGEX Forward:	5' CTGGCAAGCCACGTTTGGTG 3'
pGEX Reverse:	5' GGAGCTGCATGTGTCAGAGG 3'

If your desired commercial universal primer is not currently stocked, the Genomics Core can order it. Users must provide their own custom sequencing primers.

Sequencher DNA Sequence Assembly Software for Windows is available to on-campus users through the OIT Software Download page. To use this software, a computer must be connected to the Notre Dame network and have KeyAccess Client software installed (also available through the OIT Software Download page). Alternatively, free software to allow sequencing chromatogram viewing includes FinchTV (multi-platform), CLC Sequence Viewer (multi-platform), 4Peaks for Mac OS X, and ABI's Sequence Scanner for Windows. ABI's Peak Scanner is free Windows software for DNA fragment length analysis.

< Back to top >

454 sequencing

High-throughput, next generation sequencing services on a Roche 454 Genome Sequencer FLX instrument are available using Roche's Titanium chemistry platform and their rapid library prep protocol. Users interested in running 454 experiments through the Genomics Core must consult with John before any services will be provided. Any DNA samples you wish to sequence must meet the following criteria:

• Double-stranded
• OD 260/280 ≥ 1.8
• Total amount ≥ 500 ng
• Concentration ≥ 5 ng/µl
• Fragment size > 1.5 kb

Sample concentration and amount must be based on PicoGreen quantitation; we can run this in the Genomics Core for you. We generate eukaryotic cDNA libraries including normalization for transcriptome sequencing. We can generate prokaryotic cDNA libraries for select organisms.

< Back to top >

Microarrays

Order forms: Affymetrix orders

The Genomics Core Facility provides Affymetrix microarray services via the Affymetrix GeneChip System: a GeneChip Hybridization Oven 640, GeneChip Fluidics Station 450, and a GeneChip Scanner 3000 7G. You must consult with Brent before any Affymetrix services will be provided. Users are expected to provide RNA samples and the Genomics Core will perform cDNA synthesis and all subsequent steps. Additionally, users are strongly encouraged to consult with Erliang Zeng, the bioinformatics core managing director, to discuss downstream data analysis.

Custom microarray services available through the core include custom printed microarrays, and NimbleGen microarrays. The Genomics Core is able to print custom microarrays with an OmniGrid 100 robotic printer; consult with Brent if you are interested in this service. Additionally, the Genomics Core houses equipment for NimbleGen microarray experiments: 4 and 12-bay NimbleGen hybridization stations and a NimbleGen MS 200 scanner (2 micron resolution, 48 slide autoloader, auto calibration, and active air filtering to control internal ozone levels). NimbleGen services are not in production currently, but users are able to run and receive assistance on NimbleGen experiments on a collaborative basis; consult with John if you are interested in running NimbleGen experiments.

< Back to top >

Miscellaneous

Order forms: Bioanalyzer orders

The Genomics Core Facility uses an Agilent 2100 BioAnalyzer for microarray and next-gen sequencing sample QC providing DNA and RNA sizing and quantitation. This separate order form is provided for users desiring stand-alone Bioanalyzer service.